Fundamental to intralimb coordination in the lower extremity, ankle-knee synergy induced by motor irradiation has long been employed to secure facilitation of paralyzed muscles. This study, a companion research subsequent to the time amplitude analysis of surface electromyography in part 1, was to investigate the recruitment strategy of irradiated muscles and prime movers during ankle isokinetic contraction at different contraction speeds (30, 60, 120 and 240 degrees/s) with time frequency analysis. The results indicated the recruitment strategies of the major irradiated muscles (ipsilateral rectus femoris/ipsilateral biceps femoris) and prime movers (anterior tibialis/gastrocnemius) were time-dependent and significantly different in terms of the instantaneous median frequency. In general, the prime movers for ankle isokinetic concentric contraction demonstrated a similar recruitment strategy, irrespective of different contraction speeds. This finding is consistent with the idea of generalized motor programs that speed is one of the constraint parameters supplied to motor programs. Nevertheless, the recruitment strategies of the irradiated muscles were highly inconsistent, varying across trials at different contraction speeds, and were not relevant to those of the prime movers. In addition, the recruitment in the irradiated muscles seemly limited to motor units of low threshold, in spite of maximal voluntary contraction of the prime movers. 相似文献
Soil samples were collected from 7 sites in the up-, mid-and down-reach along and nearby the wastewater irrigation channel, western Shenyang of China. The concentrations of selected pollutants (mineral oil, PAHs - polycycle aromatic hydrocarbons and Cd) were determined by UV spectrometer, HPLC and AAS (atomic adsorption spectrometer) spectrometer, respectively. Toxicity effects of soils were evaluated by seedling emergence test with root length of wheat as the end-point and by earthworms test with the mortality rate and inhibition rates of body weight as endpoints. Results showed accumulation of pollutants for most soils with concentration of 200.2 mg.kg−1∼1600 mg.kg−1 for mineral oil, 0.33 mg.kg−1∼1.81 mg.kg−1 for Cd and 900.16 mg.kg−1 ∼ 2737.91 mg.kg−1 for PAHs. The inhibition rates of root elongation were from −20% up to 40 %, and mortality rates of earthworms ranged from 0%∼40% from the exposure period of two weeks to eight weeks by sampling interval of two weeks, the inhibition rates of earthworm growth were from −19.36% to 34.53%, showing effects of stimulation at 2 weeks to an increasing effects of inhibition at 4, 6 and 8 weeks, respectively. Mortality rates correlated with the loss of body weight of earthworms.
This study indicated the potential risk of pollutants of environmental low content in soil by the determination of selected chemicals combined with toxicity indexes.
Minimally invasive techniques were used to collect urine with an external catheter together with automated intermittent monitoring of arterial blood pressure in awake male baboons. Using endogenous creatinine, 24-hour creatinine clearances were measured for 2 to 3 consecutive days in four intact and in four uninephrectomized baboons. Despite large differences in urinary volume and sodium excretion, reproducibility of 24-hour creatinine clearances was within 15% in 15 of 19 studies obtained from 6 of 8 animals. Arterial blood pressure was monitored intermittently at 30 to 60 minute intervals over 24 hours with a Dinamap monitor and recorder. Mean blood pressure averaged 71 +/- 4.4 to 89 +/- 5.5 mm Hg in different animals. Blood pressure tended to be lower at night than during the day. In separate studies using 15 to 60 minute urine collection periods, inulin clearance was compared in awake and in anesthetized animals with endogenous or exogenous creatinine clearance measured simultaneously. The clearance of creatinine systematically exceeded the clearance of inulin, even in intact animals with a normal serum creatinine. The creatinine-to-inulin clearance ratio averaged 1.16 +/- 0.03 at a serum concentration of 0.7 to 0.8 mg/dl; 1.27 +/- 0.03 at a serum creatinine of 1.0 to 1.1 mg/dl and 1.56 +/- 0.04 at a serum creatinine greater than 10 mg/dl. All values exceed unity significantly (p less than 0.001). Thus, renal function, including inulin clearance, can be measured in awake baboons. Duplicate or triplicate 24-hour urine collections are needed to assess the reliability of creatinine excretion. However, creatinine clearance overestimates glomerular filtration rate, as it does in humans. 相似文献
A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen. 相似文献
We have cloned cDNA of a testis-specific histone, TH2B (a variant of H2B), and rat somatic H2B gene to investigate regulation of testis-specific histone genes during rat spermatogenesis. The amino acid sequences deduced from DNA sequences show extensive sequence divergence in the N-terminal third of the two histones. The rest is highly conserved. One cysteine residue was found in TH2B. No cysteine is present in somatic histones except in H3 histone. We investigated the expression of TH2B and H2B genes using the regions of sequence divergence as hybridization probes. The TH2B gene is expressed only in the testis, and the expression of this gene is detected 14 days after birth, reaching a maximum at Day 20. The level of H2B mRNA shows a reciprocal pattern. This contrasting pattern can be explained by the gradually changing proportion of spermatogonia and spermatocytes with testicular maturation. In situ cytohybridization studies show that H2B gene is expressed primarily in proliferating spermatogonia and preleptotene spermatocytes, whereas TH2B gene is expressed exclusively in pachytene spermatocytes which first appear in testis about 14 days after birth. H2B and TH2B genes appear to be ideal markers for the study of proliferation and differentiation events in spermatogenesis and their regulatory mechanisms. 相似文献
A new beta-lactam-inducible penicillin-binding protein (PBP) that has extremely low affinity to penicillin and most other beta-lactam antibiotics has been widely found in highly beta-lactam(methicillin)-resistant Staphylococcus aureus (MRSA). The gene for this protein was sequenced and the nucleotide sequence in its promoter and close upstream area was found to show close similarity with that of staphylococcal penicillinase, while the amino acid sequence over a wide range of the molecule was found to be similar to those of two PBPs of Escherichia coli, the shape-determining protein (PBP 2) and septum-forming one (PBP 3). Probably the MRSA PBP (Mr 76462) evolved by recombination of two genes: an inducible type I penicillinase gene and a PBP gene of a bacterium, causing the formation of a beta-lactam-inducible MRSA PBP. 相似文献
The role of Ca2+ on 32Pi incorporation into polyphosphoinositides (PPI) of rat cortical synaptosomes was studied. Stimulation of muscarinic receptor by carbachol (1 mM) resulted in a decrease in 32Pi incorporation into phosphatidylinositol-4,5-bisphophaphate (TPI) and phosphatidylinositol-4-phosphate (DPI), and an increase in 32Pi incorporation into phosphatidylinositol (PI) and phosphatidic acid (PA), whereas no significant effect on other membrane phospholipids was found. This response could be blocked by atropine (1 microM). The stimulatory effect of carbachol required Ca2+ in the medium; the presence of 0.5 mM EGTA blocked the effect of carbachol on PPI turnover completely. Calcium ionophore A23187, at 1 microM, had a similar effect on PPI turnover by carbachol (1 mM). At higher concentrations (10-100 microM) of A23187, the PPI turnover rate was much enhanced. Depolarization of the membrane by high potassium (60 mM) in the presence of calcium resulted in an enhanced PPI turnover, which was similar to the results of the carbachol (1 mM) effect but to a lesser extent. Calcium antagonists, diltiazem and trifluoperazine, at 10 microM could block the carbachol effect on 32Pi incorporation into PPI in this preparation. Our results suggest that the enhancement of PPI turnover in rat cortical synaptosomes by carbachol, calcium ionophore or high potassium requires Ca2+, and it can be blocked by compounds which interfere with the availability of this ion, such as EGTA or calcium antagonists. 相似文献
A simplified procedure for the isolation and purification of 124-kDa phytochrome from etiolated Avena seedlings has been developed using the method of ammonium sulfate back-extraction. After hydroxyapatite chromatography of seedling tissue extracts, the pooled phytochrome was subjected to ammonium sulfate back-extraction instead of the usual application to an Affi-Gel Blue column. The resulting phytochrome had specific absorbance ratios (SAR = A666/A280) ranging from 0.85 to 0.95. Subsequent Bio-Gel filtration chromatography yielded highly pure 124-kDa phytochrome with SAR values ranging from 0.99 to 1.13. The absorption maxima of 124-kDa phytochrome were at 280, 379, and 666 nm for the red absorbing form of phytochrome (Pr) and at 280, 400 and 730 nm for the far-red absorbing form (Pfr). The A730/A673 ratio in Pfr was found to be 1.5 to 1.6. The mole fraction of Pfr under red light photoequilibrium was 0.88. No dark reversion was detected within 5 h at 3 degrees C. A photoreversible far-uv-circular dichroism was observable with all phytochrome preparations examined. Fluorescence and phosphorescence lifetimes were measured to further characterize the differences between the phytochromes prepared under different conditions. The Trp fluorescence and phosphorescence lifetimes of Pr and Pfr with the chromophore "X", probably polyphenolic in nature, were significantly shorter than those of phytochrome without the contaminant X. The short lifetime of the fluorescence of the Pr chromophore is attributable to X in the former. 相似文献